Basic information for LINC00343-326-10aa-2
| Peptide Name | LINC00343-326-10aa-2 |
| Genome Position | chr13:105705654-105705683[+] |
| Species | Human |
| Peptide Sequence | MLSSIQIIDL |
| Peptide Length | 10 |
| Unique | No (LINC00343-204-10aa-2) |
| Grand Average of Hydropathicity | 1.44 |
| Relative Molecular Mass | 1294.49 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000226620;LINC00343 |
| Transcript ID/Name | ENST00000671026;LINC00343-326 |
| Transcript Length | 2023 |
| Coding Ability | 0.5358 |
| DNA Sequence Corresponding to Peptide | ATGCTGTCAAGCATTCAAATAATCGACCTA |
|
Conservation
|
|
|