Basic information for LINC00345-202-10aa
| Peptide Name | LINC00345-202-10aa |
| Genome Position | chr13:52483312-52483341[-] |
| Species | Human |
| Peptide Sequence | MGENFCNLSV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.35 |
| Relative Molecular Mass | 1275.41 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000235660;LINC00345 |
| Transcript ID/Name | ENST00000647901;LINC00345-202 |
| Transcript Length | 1805 |
| Coding Ability | 0.6515 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTTGCAATCTGTCTGTC |
|
Conservation
|
|
|