Basic information for LINC00518-206-10aa-2
| Peptide Name | LINC00518-206-10aa-2 |
| Genome Position | chr6:10434679-10434708[-] |
| Species | Human |
| Peptide Sequence | MCPLPRVTGL |
| Peptide Length | 10 |
| Unique | No (LINC00518-205-10aa-1) |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1248.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000183674;LINC00518 |
| Transcript ID/Name | ENST00000655125;LINC00518-206 |
| Transcript Length | 1433 |
| Coding Ability | 0.5471 |
| DNA Sequence Corresponding to Peptide | ATGTGTCCTCTCCCCAGAGTCACAGGATTA |
|
Conservation
|
|
|