Basic information for LINC00607-207-10aa-2
| Peptide Name | LINC00607-207-10aa-2 |
| Genome Position | chr2:215619643-215619649,215621328-215621350[-] |
| Species | Human |
| Peptide Sequence | MGHFSLPSVP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.43 |
| Relative Molecular Mass | 1233.39 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000235770;LINC00607 |
| Transcript ID/Name | ENST00000654368;LINC00607-207 |
| Transcript Length | 1404 |
| Coding Ability | 0.339 |
| DNA Sequence Corresponding to Peptide | ATGGGACATTTCAGCTTGCCAAGTGTCCCT |
m6A
|
Conservation
|
|
|