Basic information for LINC00639-209-10aa
| Peptide Name | LINC00639-209-10aa |
| Genome Position | chr14:38738565-38738594[-] |
| Species | Human |
| Peptide Sequence | MYRSLVYIKF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.54 |
| Relative Molecular Mass | 1481.75 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000259070;LINC00639 |
| Transcript ID/Name | ENST00000655593;LINC00639-209 |
| Transcript Length | 3711 |
| Coding Ability | 0.5837 |
| DNA Sequence Corresponding to Peptide | ATGTACAGATCACTGGTATATATTAAATTT |
|
Conservation
|
|
|