Basic information for LINC00639-213-10aa-2
| Peptide Name | LINC00639-213-10aa-2 |
| Genome Position | chr14:38748535-38748564[-] |
| Species | Human |
| Peptide Sequence | MLKITEAQFS |
| Peptide Length | 10 |
| Unique | No (LINC00639-205-10aa-1,LINC00639-210-10aa-2) |
| Grand Average of Hydropathicity | 0.24 |
| Relative Molecular Mass | 1329.55 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000259070;LINC00639 |
| Transcript ID/Name | ENST00000670347;LINC00639-213 |
| Transcript Length | 5418 |
| Coding Ability | 0.4472 |
| DNA Sequence Corresponding to Peptide | ATGTTAAAAATCACTGAGGCACAATTCTCT |
|
Conservation
|
|
|