Basic information for LINC00662-260-10aa-2
| Peptide Name | LINC00662-260-10aa-2 |
| Genome Position | chr19:27686872-27686877,27701622-27701645[-] |
| Species | Human |
| Peptide Sequence | MISAFPTENL |
| Peptide Length | 10 |
| Unique | No (LINC00662-221-10aa-1,LINC00662-235-10aa-1,LINC00662-258-10aa-1,LINC00662-259-10aa-2,LINC00662-261-10aa-1,LINC00662-277-10aa-1) |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1284.46 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000261824;LINC00662 |
| Transcript ID/Name | ENST00000666409;LINC00662-260 |
| Transcript Length | 1222 |
| Coding Ability | 0.1506 |
| DNA Sequence Corresponding to Peptide | ATGATTTCTGCATTTCCAACTGAGAATCTA |
|
Conservation
|
|
|