Basic information for LINC00707-208-10aa
| Peptide Name | LINC00707-208-10aa |
| Genome Position | chr10:6879165-6879194[+] |
| Species | Human |
| Peptide Sequence | MLTNPAQIGL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.61 |
| Relative Molecular Mass | 1219.44 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000238266;LINC00707 |
| Transcript ID/Name | ENST00000650314;LINC00707-208 |
| Transcript Length | 3105 |
| Coding Ability | 0.2245 |
| DNA Sequence Corresponding to Peptide | ATGTTGACAAACCCAGCCCAGATAGGTCTA |
|
Conservation
|
|
|