Basic information for LINC00839-204-10aa-2
| Peptide Name | LINC00839-204-10aa-2 |
| Genome Position | chr10:42493010-42493039[+] |
| Species | Human |
| Peptide Sequence | MVIWWNLDPK |
| Peptide Length | 10 |
| Unique | No (LINC00839-209-10aa-2) |
| Grand Average of Hydropathicity | 0.01 |
| Relative Molecular Mass | 1463.68 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000185904;LINC00839 |
| Transcript ID/Name | ENST00000659650;LINC00839-204 |
| Transcript Length | 3982 |
| Coding Ability | 0.3938 |
| DNA Sequence Corresponding to Peptide | ATGGTGATATGGTGGAACCTCGACCCCAAA |
m6A
|
Conservation
|
|
|