Basic information for LINC00937-205-10aa-1
| Peptide Name | LINC00937-205-10aa-1 |
| Genome Position | chr12:8387761-8387790[-] |
| Species | Human |
| Peptide Sequence | MVVVGASCVL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.56 |
| Relative Molecular Mass | 1139.39 |
| Experimental Evidences | 1:lncORF |
| lncRNA ID/Name | ENSG00000226091;LINC00937 |
| Transcript ID/Name | ENST00000538304;LINC00937-205 |
| Transcript Length | 2157 |
| Coding Ability | 0.4075 |
| DNA Sequence Corresponding to Peptide | ATGGTGGTGGTGGGGGCATCCTGTGTATTG |
lncORF
|
Conservation
|
|
|