Basic information for LINC00937-207-10aa
| Peptide Name | LINC00937-207-10aa |
| Genome Position | chr12:8297107-8297136[-] |
| Species | Human |
| Peptide Sequence | MLLTVIFKLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.94 |
| Relative Molecular Mass | 1326.67 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000226091;LINC00937 |
| Transcript ID/Name | ENST00000544461;LINC00937-207 |
| Transcript Length | 3033 |
| Coding Ability | 0.5905 |
| DNA Sequence Corresponding to Peptide | ATGTTGTTGACAGTCATCTTTAAACTGAGT |
m6A
|
Conservation
|
|
|