Basic information for LINC01010-210-10aa
| Peptide Name | LINC01010-210-10aa |
| Genome Position | chr6:134504035-134504064[+] |
| Species | Human |
| Peptide Sequence | MSNYHISLAT |
| Peptide Length | 10 |
| Unique | No (LINC01010-201-10aa) |
| Grand Average of Hydropathicity | 0.17 |
| Relative Molecular Mass | 1298.45 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236700;LINC01010 |
| Transcript ID/Name | ENST00000660399;LINC01010-210 |
| Transcript Length | 1642 |
| Coding Ability | 0.5244 |
| DNA Sequence Corresponding to Peptide | ATGAGTAATTATCACATTTCTTTGGCTACT |
|
Conservation
|
|
|