Basic information for LINC01191-205-10aa
| Peptide Name | LINC01191-205-10aa |
| Genome Position | chr2:113970719-113970748[+] |
| Species | Human |
| Peptide Sequence | MFLQVFQRSS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.24 |
| Relative Molecular Mass | 1404.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000234199;LINC01191 |
| Transcript ID/Name | ENST00000663402;LINC01191-205 |
| Transcript Length | 922 |
| Coding Ability | 0.5336 |
| DNA Sequence Corresponding to Peptide | ATGTTCCTACAAGTCTTCCAGAGGAGTTCT |
|
Conservation
|
|
|