Basic information for LINC01278-212-10aa-1
| Peptide Name | LINC01278-212-10aa-1 |
| Genome Position | chrX:63398047-63398076[-] |
| Species | Human |
| Peptide Sequence | MVTWNPILQY |
| Peptide Length | 10 |
| Unique | No (LINC01278-211-10aa-1,LINC01278-220-10aa-1,LINC01278-227-10aa-1,LINC01278-231-10aa-1) |
| Grand Average of Hydropathicity | 0.29 |
| Relative Molecular Mass | 1426.67 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000235437;LINC01278 |
| Transcript ID/Name | ENST00000656953;LINC01278-212 |
| Transcript Length | 2501 |
| Coding Ability | 0.3239 |
| DNA Sequence Corresponding to Peptide | ATGGTGACCTGGAATCCTATTCTACAATAT |
|
Conservation
|
|
|