Basic information for LINC01278-230-10aa
| Peptide Name | LINC01278-230-10aa |
| Genome Position | chrX:63223171-63223200[-] |
| Species | Human |
| Peptide Sequence | MLVEKLLIER |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.66 |
| Relative Molecular Mass | 1405.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000235437;LINC01278 |
| Transcript ID/Name | ENST00000667050;LINC01278-230 |
| Transcript Length | 1417 |
| Coding Ability | 0.2011 |
| DNA Sequence Corresponding to Peptide | ATGTTGGTTGAAAAACTACTTATTGAACGT |
|
Conservation
|
|
|