Basic information for LINC01278-235-10aa
| Peptide Name | LINC01278-235-10aa |
| Genome Position | chrX:63427584-63427613[-] |
| Species | Human |
| Peptide Sequence | MRVISRCSNF |
| Peptide Length | 10 |
| Unique | No (LINC01278-202-10aa) |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1374.58 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000235437;LINC01278 |
| Transcript ID/Name | ENST00000670242;LINC01278-235 |
| Transcript Length | 4744 |
| Coding Ability | 0.4606 |
| DNA Sequence Corresponding to Peptide | ATGCGGGTTATCTCCCGTTGCTCCAATTTC |
m6A
|
Conservation
|
|
|