Basic information for LINC01331-202-10aa
| Peptide Name | LINC01331-202-10aa |
| Genome Position | chr5:74393820-74393849[-] |
| Species | Human |
| Peptide Sequence | MSYLYFASPI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.9 |
| Relative Molecular Mass | 1353.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000248673;LINC01331 |
| Transcript ID/Name | ENST00000657957;LINC01331-202 |
| Transcript Length | 1724 |
| Coding Ability | 0.3695 |
| DNA Sequence Corresponding to Peptide | ATGTCATACCTCTACTTTGCCTCCCCCATT |
|
Conservation
|
|
|