Basic information for LINC01335-201-10aa
| Peptide Name | LINC01335-201-10aa |
| Genome Position | chr5:74308142-74308171[-] |
| Species | Human |
| Peptide Sequence | MVELKAKSAI |
| Peptide Length | 10 |
| Unique | No (LINC01335-202-10aa) |
| Grand Average of Hydropathicity | 0.59 |
| Relative Molecular Mass | 1251.48 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000248942;LINC01335 |
| Transcript ID/Name | ENST00000507890;LINC01335-201 |
| Transcript Length | 1249 |
| Coding Ability | 0.4259 |
| DNA Sequence Corresponding to Peptide | ATGGTAGAGTTAAAGGCCAAATCTGCCATA |
|
Conservation
|
|
|