Basic information for LINC01445-205-10aa-4
| Peptide Name | LINC01445-205-10aa-4 |
| Genome Position | chr7:54450784-54450813[+] |
| Species | Human |
| Peptide Sequence | MDNLGLFNRL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.07 |
| Relative Molecular Mass | 1354.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000231427;LINC01445 |
| Transcript ID/Name | ENST00000659445;LINC01445-205 |
| Transcript Length | 6099 |
| Coding Ability | 0.2569 |
| DNA Sequence Corresponding to Peptide | ATGGACAACCTGGGACTATTCAACCGATTA |
|
Conservation
|
|
|