Basic information for LINC01535-207-10aa
| Peptide Name | LINC01535-207-10aa |
| Genome Position | chr19:37257347-37257376[+] |
| Species | Human |
| Peptide Sequence | MHAPVRVRLF |
| Peptide Length | 10 |
| Unique | No (LINC01535-202-10aa,LINC01535-206-10aa,LINC01535-210-10aa-2) |
| Grand Average of Hydropathicity | 0.49 |
| Relative Molecular Mass | 1387.65 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000226686;LINC01535 |
| Transcript ID/Name | ENST00000659822;LINC01535-207 |
| Transcript Length | 1005 |
| Coding Ability | 0.5005 |
| DNA Sequence Corresponding to Peptide | ATGCACGCCCCGGTGCGTGTGCGTCTCTTC |
|
Conservation
|
|
|