Basic information for LINC01535-209-10aa
| Peptide Name | LINC01535-209-10aa |
| Genome Position | chr19:37264059-37264088[+] |
| Species | Human |
| Peptide Sequence | MVLVSFYKSC |
| Peptide Length | 10 |
| Unique | No (LINC00665-207-10aa,LINC01535-208-10aa,LINC00665-219-10aa-2,LINC00665-224-10aa-2) |
| Grand Average of Hydropathicity | 1.26 |
| Relative Molecular Mass | 1338.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000226686;LINC01535 |
| Transcript ID/Name | ENST00000664190;LINC01535-209 |
| Transcript Length | 2945 |
| Coding Ability | 0.4781 |
| DNA Sequence Corresponding to Peptide | ATGGTTTTAGTCTCATTCTATAAGTCTTGC |
|
Conservation
|
|
|