Basic information for LINC01535-210-10aa-1
| Peptide Name | LINC01535-210-10aa-1 |
| Genome Position | chr19:37256221-37256250[+] |
| Species | Human |
| Peptide Sequence | MWKVSFFALI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.62 |
| Relative Molecular Mass | 1403.67 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000226686;LINC01535 |
| Transcript ID/Name | ENST00000666743;LINC01535-210 |
| Transcript Length | 1171 |
| Coding Ability | 0.4893 |
| DNA Sequence Corresponding to Peptide | ATGTGGAAAGTGAGTTTCTTTGCGCTTATC |
|
Conservation
|
|
|