Basic information for LINC01609-201-10aa
| Peptide Name | LINC01609-201-10aa |
| Genome Position | chr8:111099025-111099054[-] |
| Species | Human |
| Peptide Sequence | MTLPVFISPF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.53 |
| Relative Molecular Mass | 1313.59 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000253103;LINC01609 |
| Transcript ID/Name | ENST00000519506;LINC01609-201 |
| Transcript Length | 424 |
| Coding Ability | 0.5495 |
| DNA Sequence Corresponding to Peptide | ATGACCTTGCCGGTGTTTATTTCTCCATTT |
|
Conservation
|
|
|