Basic information for LINC01609-208-10aa
| Peptide Name | LINC01609-208-10aa |
| Genome Position | chr8:111184636-111184665[-] |
| Species | Human |
| Peptide Sequence | MSLLLLPKNK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.34 |
| Relative Molecular Mass | 1318.61 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000253103;LINC01609 |
| Transcript ID/Name | ENST00000663639;LINC01609-208 |
| Transcript Length | 671 |
| Coding Ability | 0.5246 |
| DNA Sequence Corresponding to Peptide | ATGAGTCTTCTGTTGCTTCCTAAAAACAAA |
|
Conservation
|
|
|