Basic information for LINC01684-203-10aa-2
| Peptide Name | LINC01684-203-10aa-2 |
| Genome Position | chr21:24489684-24489713[+] |
| Species | Human |
| Peptide Sequence | MSLCPLQGHG |
| Peptide Length | 10 |
| Unique | No (AC116611.1-201-10aa-1) |
| Grand Average of Hydropathicity | 0.21 |
| Relative Molecular Mass | 1204.38 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237484;LINC01684 |
| Transcript ID/Name | ENST00000453784;LINC01684-203 |
| Transcript Length | 2908 |
| Coding Ability | 0.4092 |
| DNA Sequence Corresponding to Peptide | ATGAGTTTATGTCCTTTGCAGGGACATGGA |
|
Conservation
|
|
|