Basic information for LINC01684-214-10aa-1
| Peptide Name | LINC01684-214-10aa-1 |
| Genome Position | chr21:24427130-24427159[+] |
| Species | Human |
| Peptide Sequence | MNASKILHKI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.12 |
| Relative Molecular Mass | 1316.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237484;LINC01684 |
| Transcript ID/Name | ENST00000656088;LINC01684-214 |
| Transcript Length | 1462 |
| Coding Ability | 0.4391 |
| DNA Sequence Corresponding to Peptide | ATGAATGCAAGTAAAATCCTACATAAAATA |
|
Conservation
|
|
|