Basic information for LINC01684-221-10aa
| Peptide Name | LINC01684-221-10aa |
| Genome Position | chr21:24480663-24480692[+] |
| Species | Human |
| Peptide Sequence | MSNIFYIKEI |
| Peptide Length | 10 |
| Unique | No (LINC01684-223-10aa,LINC01684-227-10aa) |
| Grand Average of Hydropathicity | 0.52 |
| Relative Molecular Mass | 1419.63 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000237484;LINC01684 |
| Transcript ID/Name | ENST00000659824;LINC01684-221 |
| Transcript Length | 1002 |
| Coding Ability | 0.482 |
| DNA Sequence Corresponding to Peptide | ATGTCCAATATATTTTACATAAAAGAAATC |
|
Conservation
|
|
|