Basic information for LINC01722-201-10aa-1
| Peptide Name | LINC01722-201-10aa-1 |
| Genome Position | chr20:12893204-12893233[-] |
| Species | Human |
| Peptide Sequence | MTPLCLRVNV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.01 |
| Relative Molecular Mass | 1307.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000233048;LINC01722 |
| Transcript ID/Name | ENST00000456265;LINC01722-201 |
| Transcript Length | 3033 |
| Coding Ability | 0.4372 |
| DNA Sequence Corresponding to Peptide | ATGACTCCCCTCTGCCTTAGGGTTAATGTG |
|
Conservation
|
|
|