Basic information for LINC01727-204-10aa
| Peptide Name | LINC01727-204-10aa |
| Genome Position | chr20:21619547-21619576[+] |
| Species | Human |
| Peptide Sequence | MIFKILHFYY |
| Peptide Length | 10 |
| Unique | No (LINC01727-214-10aa-1) |
| Grand Average of Hydropathicity | 1.06 |
| Relative Molecular Mass | 1536.83 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000279082;LINC01727 |
| Transcript ID/Name | ENST00000624385;LINC01727-204 |
| Transcript Length | 940 |
| Coding Ability | 0.5415 |
| DNA Sequence Corresponding to Peptide | ATGATCTTTAAAATTTTGCATTTTTATTAT |
|
Conservation
|
|
|