Basic information for LINC01727-211-10aa-1
| Peptide Name | LINC01727-211-10aa-1 |
| Genome Position | chr20:21656724-21656753[+] |
| Species | Human |
| Peptide Sequence | MTFTIPPLWD |
| Peptide Length | 10 |
| Unique | No (LINC01727-207-10aa-2,LINC01727-213-10aa-1,LINC01727-216-10aa-2) |
| Grand Average of Hydropathicity | 0.4 |
| Relative Molecular Mass | 1382.64 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000279082;LINC01727 |
| Transcript ID/Name | ENST00000661947;LINC01727-211 |
| Transcript Length | 1240 |
| Coding Ability | 0.2935 |
| DNA Sequence Corresponding to Peptide | ATGACCTTCACCATACCACCACTCTGGGAC |
|
Conservation
|
|
|