Basic information for LINC01727-212-10aa-1
| Peptide Name | LINC01727-212-10aa-1 |
| Genome Position | chr20:21616746-21616775[+] |
| Species | Human |
| Peptide Sequence | MNIIYLPVFQ |
| Peptide Length | 10 |
| Unique | No (LINC01727-206-10aa-3) |
| Grand Average of Hydropathicity | 1.18 |
| Relative Molecular Mass | 1399.65 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000279082;LINC01727 |
| Transcript ID/Name | ENST00000663538;LINC01727-212 |
| Transcript Length | 4540 |
| Coding Ability | 0.4615 |
| DNA Sequence Corresponding to Peptide | ATGAACATAATTTACTTACCAGTTTTCCAG |
|
Conservation
|
|
|