Basic information for LINC01814-203-10aa-1
| Peptide Name | LINC01814-203-10aa-1 |
| Genome Position | chr2:8563889-8563918[-] |
| Species | Human |
| Peptide Sequence | MVGTITQPAA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.73 |
| Relative Molecular Mass | 1150.38 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236008;LINC01814 |
| Transcript ID/Name | ENST00000454224;LINC01814-203 |
| Transcript Length | 8839 |
| Coding Ability | 0.4814 |
| DNA Sequence Corresponding to Peptide | ATGGTGGGAACCATCACACAGCCAGCTGCA |
|
Conservation
|
|
|