Basic information for LINC01949-205-10aa-3
| Peptide Name | LINC01949-205-10aa-3 |
| Genome Position | chr5:87049466-87049495[-] |
| Species | Human |
| Peptide Sequence | MCDYILIHWL |
| Peptide Length | 10 |
| Unique | No (LINC01949-203-10aa-2,LINC01949-204-10aa-4) |
| Grand Average of Hydropathicity | 1.21 |
| Relative Molecular Mass | 1468.72 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000233828;LINC01949 |
| Transcript ID/Name | ENST00000666497;LINC01949-205 |
| Transcript Length | 2335 |
| Coding Ability | 0.5542 |
| DNA Sequence Corresponding to Peptide | ATGTGCGATTATATACTGATTCATTGGCTG |
|
Conservation
|
|
|