Basic information for LINC02217-214-10aa
| Peptide Name | LINC02217-214-10aa |
| Genome Position | chr5:17413008-17413037[+] |
| Species | Human |
| Peptide Sequence | MPFLQKVGFL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.99 |
| Relative Molecular Mass | 1341.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000248455;LINC02217 |
| Transcript ID/Name | ENST00000668161;LINC02217-214 |
| Transcript Length | 3512 |
| Coding Ability | 0.3747 |
| DNA Sequence Corresponding to Peptide | ATGCCATTCCTGCAGAAGGTGGGTTTCCTC |
|
Conservation
|
|
|