Basic information for LINC02223-205-10aa-3
| Peptide Name | LINC02223-205-10aa-3 |
| Genome Position | chr5:17933212-17933241[+] |
| Species | Human |
| Peptide Sequence | MSLSPAKVYP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.17 |
| Relative Molecular Mass | 1254.44 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000249937;LINC02223 |
| Transcript ID/Name | ENST00000650405;LINC02223-205 |
| Transcript Length | 4660 |
| Coding Ability | 0.4064 |
| DNA Sequence Corresponding to Peptide | ATGTCCCTGTCCCCAGCAAAAGTTTACCCC |
|
Conservation
|
|
|