Basic information for LINC02223-217-10aa-1
| Peptide Name | LINC02223-217-10aa-1 |
| Genome Position | chr5:17788283-17788312[+] |
| Species | Human |
| Peptide Sequence | MQSFIFTYLK |
| Peptide Length | 10 |
| Unique | No (LINC02223-218-10aa) |
| Grand Average of Hydropathicity | 0.56 |
| Relative Molecular Mass | 1439.71 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000249937;LINC02223 |
| Transcript ID/Name | ENST00000665617;LINC02223-217 |
| Transcript Length | 692 |
| Coding Ability | 0.5535 |
| DNA Sequence Corresponding to Peptide | ATGCAGTCATTTATATTCACCTATTTAAAA |
|
Conservation
|
|
|