Basic information for LINC02232-203-10aa
| Peptide Name | LINC02232-203-10aa |
| Genome Position | chr4:65005388-65005417[-] |
| Species | Human |
| Peptide Sequence | MPHRFQVLAV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.59 |
| Relative Molecular Mass | 1359.6 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000250125;LINC02232 |
| Transcript ID/Name | ENST00000657399;LINC02232-203 |
| Transcript Length | 1468 |
| Coding Ability | 0.4816 |
| DNA Sequence Corresponding to Peptide | ATGCCACACAGGTTTCAGGTACTAGCTGTT |
|
Conservation
|
|
|