Basic information for LINC02232-207-10aa
| Peptide Name | LINC02232-207-10aa |
| Genome Position | chr4:64968682-64968711[-] |
| Species | Human |
| Peptide Sequence | MICVSTHISS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.13 |
| Relative Molecular Mass | 1239.45 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000250125;LINC02232 |
| Transcript ID/Name | ENST00000667167;LINC02232-207 |
| Transcript Length | 878 |
| Coding Ability | 0.4806 |
| DNA Sequence Corresponding to Peptide | ATGATTTGTGTCTCCACTCATATCTCATCT |
|
Conservation
|
|
|