Basic information for LINC02235-204-10aa-2
| Peptide Name | LINC02235-204-10aa-2 |
| Genome Position | chr8:81873073-81873102[+] |
| Species | Human |
| Peptide Sequence | MTADKFLFIL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.33 |
| Relative Molecular Mass | 1360.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000254689;LINC02235 |
| Transcript ID/Name | ENST00000656073;LINC02235-204 |
| Transcript Length | 2581 |
| Coding Ability | 0.3824 |
| DNA Sequence Corresponding to Peptide | ATGACTGCTGACAAATTCCTCTTTATTTTA |
|
Conservation
|
|
|