Basic information for LINC02268-205-10aa
| Peptide Name | LINC02268-205-10aa |
| Genome Position | chr4:174114026-174114055[-] |
| Species | Human |
| Peptide Sequence | MHSTALIPPK |
| Peptide Length | 10 |
| Unique | No (LINC02268-201-10aa,LINC02268-204-10aa,LINC02268-206-10aa-3,LINC02268-207-10aa-2) |
| Grand Average of Hydropathicity | 0.02 |
| Relative Molecular Mass | 1256.5 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000248174;LINC02268 |
| Transcript ID/Name | ENST00000666320;LINC02268-205 |
| Transcript Length | 554 |
| Coding Ability | 0.1354 |
| DNA Sequence Corresponding to Peptide | ATGCATTCTACTGCTTTAATCCCACCTAAG |
|
Conservation
|
|
|