Basic information for LINC02605-201-10aa-5
| Peptide Name | LINC02605-201-10aa-5 |
| Genome Position | chr8:78839824-78839853[+] |
| Species | Human |
| Peptide Sequence | MGPSSIWIPK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.09 |
| Relative Molecular Mass | 1277.47 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000261618;LINC02605 |
| Transcript ID/Name | ENST00000565297;LINC02605-201 |
| Transcript Length | 5219 |
| Coding Ability | 0.4175 |
| DNA Sequence Corresponding to Peptide | ATGGGGCCTTCCTCCATTTGGATCCCTAAG |
|
Conservation
|
|
|