Basic information for LINC02614-203-10aa
| Peptide Name | LINC02614-203-10aa |
| Genome Position | chr3:125888656-125888685[-] |
| Species | Human |
| Peptide Sequence | MQLSFVEVLL |
| Peptide Length | 10 |
| Unique | No (LINC02614-209-10aa) |
| Grand Average of Hydropathicity | 1.67 |
| Relative Molecular Mass | 1340.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241288;LINC02614 |
| Transcript ID/Name | ENST00000597749;LINC02614-203 |
| Transcript Length | 723 |
| Coding Ability | 0.3278 |
| DNA Sequence Corresponding to Peptide | ATGCAACTCAGCTTTGTGGAAGTGCTTCTC |
|
Conservation
|
|
|