Basic information for LINC02622-204-10aa-2
| Peptide Name | LINC02622-204-10aa-2 |
| Genome Position | chr10:70955187-70955216[+] |
| Species | Human |
| Peptide Sequence | MPSTCHLAPG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.17 |
| Relative Molecular Mass | 1175.37 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259267;LINC02622 |
| Transcript ID/Name | ENST00000664582;LINC02622-204 |
| Transcript Length | 1863 |
| Coding Ability | 0.4407 |
| DNA Sequence Corresponding to Peptide | ATGCCCTCCACCTGCCACCTTGCACCTGGC |
|
Conservation
|
|
|