Basic information for LINC02694-209-10aa
| Peptide Name | LINC02694-209-10aa |
| Genome Position | chr15:39057799-39057828[+] |
| Species | Human |
| Peptide Sequence | MKKTLAHACL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.39 |
| Relative Molecular Mass | 1277.59 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000175779;LINC02694 |
| Transcript ID/Name | ENST00000647456;LINC02694-209 |
| Transcript Length | 2032 |
| Coding Ability | 0.4257 |
| DNA Sequence Corresponding to Peptide | ATGAAAAAAACACTTGCACACGCATGTTTA |
|
Conservation
|
|
|