Basic information for LINC02742-204-10aa-2
| Peptide Name | LINC02742-204-10aa-2 |
| Genome Position | chr11:29064228-29064257[+] |
| Species | Human |
| Peptide Sequence | MIHFQNVTHC |
| Peptide Length | 10 |
| Unique | No (LINC02742-201-10aa-2) |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1391.63 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000249867;LINC02742 |
| Transcript ID/Name | ENST00000666135;LINC02742-204 |
| Transcript Length | 1155 |
| Coding Ability | 0.3368 |
| DNA Sequence Corresponding to Peptide | ATGATACATTTTCAGAATGTAACCCATTGT |
|
Conservation
|
|
|