Basic information for LINC02789-201-10aa-1
| Peptide Name | LINC02789-201-10aa-1 |
| Genome Position | chr1:199392027-199392056[+] |
| Species | Human |
| Peptide Sequence | MLVSVLVRVL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.48 |
| Relative Molecular Mass | 1290.61 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000231718;LINC02789 |
| Transcript ID/Name | ENST00000452199;LINC02789-201 |
| Transcript Length | 2296 |
| Coding Ability | 0.4347 |
| DNA Sequence Corresponding to Peptide | ATGTTAGTGTCTGTATTAGTCAGGGTTCTC |
|
Conservation
|
|
|