Basic information for LINC02792-201-10aa-1
| Peptide Name | LINC02792-201-10aa-1 |
| Genome Position | chr1:79345084-79345113[+] |
| Species | Human |
| Peptide Sequence | MRGVTVTKIF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1313.65 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285462;LINC02792 |
| Transcript ID/Name | ENST00000645557;LINC02792-201 |
| Transcript Length | 1507 |
| Coding Ability | 0.4585 |
| DNA Sequence Corresponding to Peptide | ATGAGAGGTGTCACTGTTACAAAAATATTT |
|
Conservation
|
|
|