Basic information for LIPC-AS1-201-10aa
| Peptide Name | LIPC-AS1-201-10aa |
| Genome Position | chr15:58435091-58435120[-] |
| Species | Human |
| Peptide Sequence | MVLISCHVLF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.37 |
| Relative Molecular Mass | 1323.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259293;LIPC-AS1 |
| Transcript ID/Name | ENST00000561083;LIPC-AS1-201 |
| Transcript Length | 2231 |
| Coding Ability | 0.4738 |
| DNA Sequence Corresponding to Peptide | ATGGTCCTCATCTCATGCCATGTTCTGTTC |
|
Conservation
|
|
|