Basic information for LMCD1-AS1-201-10aa
| Peptide Name | LMCD1-AS1-201-10aa |
| Genome Position | chr3:8222410-8222439[-] |
| Species | Human |
| Peptide Sequence | MHVIAPKTFP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.42 |
| Relative Molecular Mass | 1302.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000227110;LMCD1-AS1 |
| Transcript ID/Name | ENST00000420095;LMCD1-AS1-201 |
| Transcript Length | 2621 |
| Coding Ability | 0.3586 |
| DNA Sequence Corresponding to Peptide | ATGCATGTTATTGCCCCAAAGACCTTCCCG |
|
Conservation
|
|
|