Basic information for LOC102549636-202-10aa
| Peptide Name | LOC102549636-202-10aa |
| Genome Position | chr3:177390041-177390070[+] |
| Species | Rat |
| Peptide Sequence | MKTVSKISAS |
| Peptide Length | 10 |
| Unique | No (LOC102549636-201-10aa) |
| Grand Average of Hydropathicity | 0.15 |
| Relative Molecular Mass | 1213.43 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSRNOG00000060067;LOC102549636 |
| Transcript ID/Name | ENSRNOT00000088310;LOC102549636-202 |
| Transcript Length | 627 |
| Coding Ability | 0.3158 |
| DNA Sequence Corresponding to Peptide | ATGAAGACAGTGAGCAAAATCTCTGCCTCT |
|
Conservation
|
|
|